ID: 1035536466_1035536473

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1035536466 1035536473
Species Human (GRCh38) Human (GRCh38)
Location 8:395048-395070 8:395070-395092
Sequence CCTCTGTTACCTGCGGTGAGCAC CTGGTGAAGGGGAATGAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 3, 4: 79} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!