ID: 1035552999_1035553010

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1035552999 1035553010
Species Human (GRCh38) Human (GRCh38)
Location 8:544628-544650 8:544644-544666
Sequence CCCCACCTGCGCACCCCCTCACC CCTCACCTGCGCCTGGGCGGCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 15, 3: 152, 4: 892} {0: 1, 1: 0, 2: 5, 3: 28, 4: 403}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!