ID: 1035556242_1035556251

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1035556242 1035556251
Species Human (GRCh38) Human (GRCh38)
Location 8:569297-569319 8:569335-569357
Sequence CCCTTGTCTGTTTGCATATTCGG CAGGGGGCGTGCCCTGTCTCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 8, 3: 38, 4: 179} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!