ID: 1035564972_1035564984

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1035564972 1035564984
Species Human (GRCh38) Human (GRCh38)
Location 8:635368-635390 8:635415-635437
Sequence CCAGCCTGAGCTTCCCTCCAAAG ACAATAGTGACAGCTAAGGCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 15, 4: 139}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!