ID: 1035608158_1035608161

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1035608158 1035608161
Species Human (GRCh38) Human (GRCh38)
Location 8:942900-942922 8:942927-942949
Sequence CCAGGAGAGCCACACGGGCATGT CTCTCCAGTGATGCGTTGCAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 1, 4: 77}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!