ID: 1035611642_1035611644

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1035611642 1035611644
Species Human (GRCh38) Human (GRCh38)
Location 8:969467-969489 8:969501-969523
Sequence CCAGTGTGCTGGAGCAGCTCGTA GAACCAACTGTTAAGTTTTTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 81} {0: 1, 1: 0, 2: 9, 3: 52, 4: 237}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!