ID: 1035635612_1035635615

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1035635612 1035635615
Species Human (GRCh38) Human (GRCh38)
Location 8:1141446-1141468 8:1141499-1141521
Sequence CCACACAGCTGATGGTTAGAAGA AATCCAGAATGTTGGTGTTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 173} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!