ID: 1035655380_1035655391

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1035655380 1035655391
Species Human (GRCh38) Human (GRCh38)
Location 8:1301281-1301303 8:1301326-1301348
Sequence CCCTTCCATGGAAGCTGCTGTCT GGGCATCATGCTCGAGCTCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 244} {0: 1, 1: 0, 2: 0, 3: 5, 4: 91}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!