ID: 1035683198_1035683205

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1035683198 1035683205
Species Human (GRCh38) Human (GRCh38)
Location 8:1503864-1503886 8:1503880-1503902
Sequence CCCCTCTTGGGGTGGTACGTGGG ACGTGGGTGGAGGACTCTGGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 13, 4: 170}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!