ID: 1035695435_1035695441

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1035695435 1035695441
Species Human (GRCh38) Human (GRCh38)
Location 8:1592079-1592101 8:1592106-1592128
Sequence CCCTTGTTGGGCCCAGACACACA GCTGCGATGGGTGCAGAGCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 134} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!