ID: 1035695438_1035695446

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1035695438 1035695446
Species Human (GRCh38) Human (GRCh38)
Location 8:1592091-1592113 8:1592142-1592164
Sequence CCAGACACACAAACAGCTGCGAT GCCCGCCCAGGCTTACCTAACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 132} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!