ID: 1035696827_1035696828

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1035696827 1035696828
Species Human (GRCh38) Human (GRCh38)
Location 8:1604110-1604132 8:1604130-1604152
Sequence CCTTCTTCATTTTGTGGACACTG CTGCAGACACTGTTCACATATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 251} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!