ID: 1035728977_1035728993

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1035728977 1035728993
Species Human (GRCh38) Human (GRCh38)
Location 8:1841831-1841853 8:1841871-1841893
Sequence CCGCGACGGGAACTGGGGCCGCG GGCGGGAACTGGGGCCGCGGCGG
Strand - +
Off-target summary No data {0: 9, 1: 2, 2: 10, 3: 63, 4: 555}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!