ID: 1035728977_1035728996

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1035728977 1035728996
Species Human (GRCh38) Human (GRCh38)
Location 8:1841831-1841853 8:1841879-1841901
Sequence CCGCGACGGGAACTGGGGCCGCG CTGGGGCCGCGGCGGGAACTGGG
Strand - +
Off-target summary No data {0: 12, 1: 1, 2: 3, 3: 21, 4: 251}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!