ID: 1035728991_1035728997

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1035728991 1035728997
Species Human (GRCh38) Human (GRCh38)
Location 8:1841867-1841889 8:1841880-1841902
Sequence CCGCGGCGGGAACTGGGGCCGCG TGGGGCCGCGGCGGGAACTGGGG
Strand - +
Off-target summary No data {0: 12, 1: 1, 2: 4, 3: 22, 4: 301}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!