ID: 1035728998_1035729016

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1035728998 1035729016
Species Human (GRCh38) Human (GRCh38)
Location 8:1841885-1841907 8:1841934-1841956
Sequence CCGCGGCGGGAACTGGGGCCGCG TGGGGCCGCGACCGGAACTGGGG
Strand - +
Off-target summary No data {0: 2, 1: 1, 2: 12, 3: 3, 4: 96}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!