ID: 1035729023_1035729043

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1035729023 1035729043
Species Human (GRCh38) Human (GRCh38)
Location 8:1841957-1841979 8:1842005-1842027
Sequence CCGCGACCGGAACTGGGGCCGCG CTGGGGCCGCGGCGGGAACTGGG
Strand - +
Off-target summary No data {0: 12, 1: 1, 2: 3, 3: 21, 4: 251}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!