ID: 1035729052_1035729060

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1035729052 1035729060
Species Human (GRCh38) Human (GRCh38)
Location 8:1842029-1842051 8:1842048-1842070
Sequence CCGCGGCGGGAACTGGGGCCGCG CGCGGCGGGAACTGGGGCCGCGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!