ID: 1035745546_1035745560

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1035745546 1035745560
Species Human (GRCh38) Human (GRCh38)
Location 8:1959993-1960015 8:1960037-1960059
Sequence CCCAGCTTCCGGGCCCCCATCTG TGATCAACAAGGAGCCTGGCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 6, 4: 133}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!