ID: 1035752219_1035752222

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1035752219 1035752222
Species Human (GRCh38) Human (GRCh38)
Location 8:2003690-2003712 8:2003722-2003744
Sequence CCACACCATTGCTACTCAAACTC GAGCAGCTCCGTCTCACTGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 176} {0: 1, 1: 0, 2: 2, 3: 10, 4: 108}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!