ID: 1035761091_1035761096

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1035761091 1035761096
Species Human (GRCh38) Human (GRCh38)
Location 8:2069399-2069421 8:2069426-2069448
Sequence CCCGCCTCCTTTTCTCTTTTCTG ACTCACTTTGCTGTCTTGCAGGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 16, 3: 246, 4: 2091} {0: 1, 1: 0, 2: 3, 3: 21, 4: 177}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!