ID: 1035767439_1035767446

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1035767439 1035767446
Species Human (GRCh38) Human (GRCh38)
Location 8:2118696-2118718 8:2118724-2118746
Sequence CCCAAGGCTGGTGGGCAAGTGGG CCCCTGCAGGACCCAGAGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 22, 4: 331} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!