ID: 1035796320_1035796325

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1035796320 1035796325
Species Human (GRCh38) Human (GRCh38)
Location 8:2360488-2360510 8:2360531-2360553
Sequence CCCAGCCTAAACTTCAGATCTTT TCTGGTTAGAAAGACCTGCATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 11, 4: 156}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!