ID: 1035797935_1035797945

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1035797935 1035797945
Species Human (GRCh38) Human (GRCh38)
Location 8:2376449-2376471 8:2376478-2376500
Sequence CCTGAGTCAATCCACAGTCCTCT GGGGAAGCTGGCAGGTCTGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 45, 4: 718}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!