ID: 1035966120_1035966125

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1035966120 1035966125
Species Human (GRCh38) Human (GRCh38)
Location 8:4193846-4193868 8:4193885-4193907
Sequence CCATTCATTCTTCAGCACCGAGA GCCACCTCCACGAAGGAAAGCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 12, 4: 128}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!