ID: 1035997116_1035997117

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1035997116 1035997117
Species Human (GRCh38) Human (GRCh38)
Location 8:4560544-4560566 8:4560557-4560579
Sequence CCTGTAGATACAGTGTGAGCTAA TGTGAGCTAAAACACTGTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 98} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!