ID: 1036001296_1036001303

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1036001296 1036001303
Species Human (GRCh38) Human (GRCh38)
Location 8:4608033-4608055 8:4608053-4608075
Sequence CCCAGAAAAGGGTGTTCCAGGTG GTGAAGGCCCTGGGAGGAGATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 10, 3: 99, 4: 807}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!