ID: 1036063559_1036063566

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1036063559 1036063566
Species Human (GRCh38) Human (GRCh38)
Location 8:5353511-5353533 8:5353547-5353569
Sequence CCCAGATTCAAGCGATTCTCCTG AGTAGCTGAGATTACAGACACGG
Strand - +
Off-target summary No data {0: 6, 1: 91, 2: 957, 3: 1711, 4: 2400}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!