ID: 1036076611_1036076621

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1036076611 1036076621
Species Human (GRCh38) Human (GRCh38)
Location 8:5509073-5509095 8:5509116-5509138
Sequence CCTTTGGATGGCGCTGGTCCTAG TGGGTTTTCCCTCAGCCGTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 46} {0: 1, 1: 0, 2: 0, 3: 12, 4: 119}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!