ID: 1036102459_1036102465

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1036102459 1036102465
Species Human (GRCh38) Human (GRCh38)
Location 8:5802073-5802095 8:5802110-5802132
Sequence CCATGTCATGGGTAGGGGAAGAA ATTATTAGGAAGGGGTCTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 23, 4: 182} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!