ID: 1036154274_1036154282

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1036154274 1036154282
Species Human (GRCh38) Human (GRCh38)
Location 8:6327339-6327361 8:6327386-6327408
Sequence CCACAGCCTTCCATCTGCAAGGG TAGTTCCAATCCAAGCTCAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 52, 4: 531} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!