ID: 1036215785_1036215791

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1036215785 1036215791
Species Human (GRCh38) Human (GRCh38)
Location 8:6878546-6878568 8:6878565-6878587
Sequence CCAGCCTGGGCCCACCCTGCAGA CAGAGCTACAACTGCCAGATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 71, 4: 489} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!