ID: 1036258074_1036258084

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1036258074 1036258084
Species Human (GRCh38) Human (GRCh38)
Location 8:7221052-7221074 8:7221091-7221113
Sequence CCCGGTGATTCAGGGGCCAACGT GCTCACAGGGACAGCGCCCCGGG
Strand - +
Off-target summary {0: 4, 1: 0, 2: 6, 3: 6, 4: 100} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!