ID: 1036278058_1036278060

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1036278058 1036278060
Species Human (GRCh38) Human (GRCh38)
Location 8:7373722-7373744 8:7373748-7373770
Sequence CCTCTTCCTTCTCAGCATCTAGT GTAATGTAGAATTTAAACACAGG
Strand - +
Off-target summary No data {0: 4, 1: 0, 2: 3, 3: 22, 4: 238}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!