ID: 1036280500_1036280509

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1036280500 1036280509
Species Human (GRCh38) Human (GRCh38)
Location 8:7396156-7396178 8:7396188-7396210
Sequence CCCAGGCACATCTCGACTGGGAA CAACGGACCAGGATGGGAGGTGG
Strand - +
Off-target summary No data {0: 2, 1: 0, 2: 1, 3: 10, 4: 167}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!