ID: 1036283240_1036283242

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1036283240 1036283242
Species Human (GRCh38) Human (GRCh38)
Location 8:7418998-7419020 8:7419025-7419047
Sequence CCATTACAATGGGGCCAAAGGGA CAGTAATTATTGAACATAGCTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!