ID: 1036304041_1036304045

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1036304041 1036304045
Species Human (GRCh38) Human (GRCh38)
Location 8:7587550-7587572 8:7587563-7587585
Sequence CCCTTCCTCGGCAGCTCGTTTAC GCTCGTTTACGACCCAAAACGGG
Strand - +
Off-target summary No data {0: 17, 1: 23, 2: 22, 3: 6, 4: 36}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!