ID: 1036314083_1036314089

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1036314083 1036314089
Species Human (GRCh38) Human (GRCh38)
Location 8:7707356-7707378 8:7707387-7707409
Sequence CCCCCAGAATTCAATAGGCCCTT ATCACACTCCATGCACTTGAAGG
Strand - +
Off-target summary {0: 4, 1: 28, 2: 23, 3: 32, 4: 122} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!