ID: 1036314581_1036314587

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1036314581 1036314587
Species Human (GRCh38) Human (GRCh38)
Location 8:7710534-7710556 8:7710551-7710573
Sequence CCCGTTTTGGGTCGTAAACGAGC ACGAGCTGCCGAGGAAGGGGTGG
Strand - +
Off-target summary {0: 17, 1: 23, 2: 22, 3: 6, 4: 36} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!