|
Left Crispr |
Right Crispr |
| Crispr ID |
1036380292 |
1036380305 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
8:8232251-8232273
|
8:8232300-8232322
|
| Sequence |
CCCTCTGCCCTCCTTTCCAAGTG |
CACAGGCTGTTCCCACTGCCTGG |
| Strand |
- |
+ |
| Off-target summary |
No data |
{0: 7, 1: 20, 2: 127, 3: 529, 4: 1395} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|