ID: 1036432242_1036432251

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1036432242 1036432251
Species Human (GRCh38) Human (GRCh38)
Location 8:8702085-8702107 8:8702111-8702133
Sequence CCTGGGCGCCCGCGCCCGGACCC GTTTCGGTCAGACCCGCCCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 45, 4: 451} {0: 1, 1: 0, 2: 0, 3: 0, 4: 16}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!