ID: 1036447313_1036447320

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1036447313 1036447320
Species Human (GRCh38) Human (GRCh38)
Location 8:8833118-8833140 8:8833142-8833164
Sequence CCAGATCCCATGAGAATTCACCA CGTGACAACACCACCAAAGGGGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 2, 3: 25, 4: 109}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!