ID: 1036454251_1036454265

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1036454251 1036454265
Species Human (GRCh38) Human (GRCh38)
Location 8:8893564-8893586 8:8893600-8893622
Sequence CCCCGGGCTCGGGCGGGAGCGCG CGGCGCTGGGAGGGCGCGATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 20, 4: 173} {0: 1, 1: 0, 2: 0, 3: 10, 4: 104}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!