ID: 1036479367_1036479375

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1036479367 1036479375
Species Human (GRCh38) Human (GRCh38)
Location 8:9124640-9124662 8:9124666-9124688
Sequence CCACTGGAGCCCCCTCTAAGAGA AAACAGGTGCTCACCCACAGGGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 0, 3: 21, 4: 260}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!