ID: 1036514330_1036514338

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1036514330 1036514338
Species Human (GRCh38) Human (GRCh38)
Location 8:9429874-9429896 8:9429910-9429932
Sequence CCTCCCAGGTTCAAGCAATTCTT CTGAGTAGACAGAATTACAGGGG
Strand - +
Off-target summary {0: 2097, 1: 26786, 2: 73786, 3: 143294, 4: 182819} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!