ID: 1036623339_1036623347

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1036623339 1036623347
Species Human (GRCh38) Human (GRCh38)
Location 8:10443829-10443851 8:10443862-10443884
Sequence CCCCTAATGGATTGGCAAGAGAA CAGGGTGGCCAGAGAGAGAAAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 21, 3: 89, 4: 719}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!