ID: 1036629278_1036629290

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1036629278 1036629290
Species Human (GRCh38) Human (GRCh38)
Location 8:10499246-10499268 8:10499287-10499309
Sequence CCGAACTTGGCAGGGGAGCCTCT GACTCACAACACATTGAAGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 7, 4: 134}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!