ID: 1036642813_1036642824

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1036642813 1036642824
Species Human (GRCh38) Human (GRCh38)
Location 8:10594598-10594620 8:10594646-10594668
Sequence CCTGAGCCGTGGAGAAGTTCATG AGGCAGGGGCTGGGTGCCAGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 21, 3: 114, 4: 931}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!