ID: 1036645468_1036645480

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1036645468 1036645480
Species Human (GRCh38) Human (GRCh38)
Location 8:10609339-10609361 8:10609375-10609397
Sequence CCATCCTACCCGCCCGGCCCTGG CTCTCTTGGTGCTGTCCTGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 380} {0: 1, 1: 0, 2: 1, 3: 50, 4: 352}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!