ID: 1036645849_1036645854

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1036645849 1036645854
Species Human (GRCh38) Human (GRCh38)
Location 8:10611214-10611236 8:10611230-10611252
Sequence CCAGCCATTCGCGGACCACAGCC CACAGCCTCTGGAGACGAGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 101} {0: 1, 1: 0, 2: 4, 3: 12, 4: 216}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!